Query (optional)   in Class  

GrainGenes Probe Report: BE405519-4B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE405519-4B
Data at Wheat_SNP
BE405519-4B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>C at 501
SNP A>G;A>T at 417;588
SNP T>C;A>T at 398;588
Reference sequence CATCTCTTTTTTTTGTGAGCCACATACTTTTTTCCCATTGTCATGTTTTTCTGTTAGCTATGGTAGTTGCAAATCTTGACTGATTTTCAGCAAGTATGAATCCCCCTTCATTCCTATGTATGGTTATTAAAATTAGTTGTAACACGTAAAGCTATATAATCATAGCCGTAAATCAGCTCAGGAATATTTTTTCAGGTAGCCCTTAATAAGCCTTCCGGTTTGCAAGTTCTGCCAAAAGGACTCTTCCAGCAGCGCACTGTTCTAGCACAACTTCAGTGGAAAGAGTGGAAGATGCCCCCATCAAGCTGCTCTAAGAGAAAAAATGTGCAGTTACATCCTGTACCTGTTCATCGATTAGGAAGGGGCACGTCAGGTTTGTAGCTTTTTGTTTAGTTCATTCTGACCAGTTGAGGCCTAGCAGATGTGAATTTTGTTCCTTGCCTGTGAAACCAGGAATCTAGGAGAAATGCATATTTGCTGTTTCTGGAGCTCTTTTCTTTACCATCCTCTAACAAAGAGCTCTTCTGCAATGAAGCCTCATTTTCCTACTAATTTTTTGCTTATAAAATGTGTCTCACAGAAAAATGATTGTTACCGCTGCATTGCCATATGTAAAAAAGTCTTCACTCTTGCTGATGACCTGCATGGTCCATGTTACTAGGTCTACTGCTT
Type
EST
SNP
PCR primers
BE405519B_F1 TGCTCAGTCTAGCTAGCTGG
BE405519_cpR1 TTTGTCTTGGCACAAAGCAG
Sequence
unknown
Linkage Group
4B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01