Query (optional)   in Class  

GrainGenes Probe Report: BE405519-4D

Probe
BE405519-4D
Data at Wheat_SNP
BE405519-4D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
[ Hide all but 1 of 6 ]
SNP C>T at 60
SNP C>T;G>A at 60;130
SNP C>T;C>A at 60;504
SNP C>T at 390
SNP C>T;G>R;C>A at 60;115;504
Reference sequence CGATTTTCAGAAAGTATGAATCTTCCTTCATCCCTATGTATGTTTAATAAAATTAGTTGCAACACTTAAAGCTATATAATCATAGCCATAAATCAGCTCACCATTTTTTTTTCAGGTCGCCCTTAACAAGCCTTCCGGTTTGCAAGTTCTGCCAAAAGGAATCTTCCAGCAGCGCACTGTTCTAGCACAGCTTCAGTGGAAAGAGTGGAAGATGCCCCCATCAAGCTGCTCTAAGAGAAAAAATGTGCAGTTACATCCTGTACCTGTTCATCGATTAGGAAGGGGCACGTCAGGTTTGTAGCTTTTTGTTTAGTTCACTCTGACCAGTTGAGGCCTAGCAGATGTGAATTTTGTTCCTTGCCTATGAAACCAGGAATCTAGGAGAAATACATATTTGCTGTTTCTGGAGCTCTTTTTTTTTACCATCCTGTAACAAAGAGCCCTTCTGCAATGAAGCCTCATTTTCCTACTAATTTTTTGGTTATAAAATGTGTCTCACAGAACAATGTTTGTTACCGCTGCATTTCCATATGTAAAAGTGAAACTC
Type
EST
SNP
PCR primers
BE405519_cpR1 TTTGTCTTGGCACAAAGCAG
BE405519D_F1 CATTGTCATGTTTGTCTGTCATT
Sequence
unknown
Linkage Group
4D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01