Query (optional)   in Class  

GrainGenes Probe Report: BE405849-5A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE405849-5A
Data at Wheat_SNP
BE405849-5A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T at 179
Reference sequence AAGGCTGTTACAATCCTCAGGAGGTTCTGAATTTCCTGAAGAAGGTCGGCTTCTCTGCTAATACAACCATCTACTTGACAGAGACATGGTGGCACAAAGGCCTGAATAATCTGAAGAGGGCATTTCCACACACTTATACCAAGGCAAGTAACTCATCCAGTACCATTTAATTAGTCCGCGTCATATTCTGTTTTCTCTTGACCAGATTTTTAACTTACAATCTGTCTTTGTGCAGGATGACATAATGCCGGCTGAGAAGAAAGGAGAATTCCTGAATTCTGGCGATTCAGACCTAGCAAGAGCCCTGGACCTCGAGGTCTGCTCGCAGACCGACG
Type
EST
SNP
PCR primers
BE405849A_R1 GCCACGTTTCCGTAGAACGTA
BE405849_cpF1 TGCAAGAAGGAAAGGCTGTT
Sequence
NSFT03P2_Contig15877
Linkage Group
5A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01