Query (optional)   in Class  

GrainGenes Probe Report: BE405849-5D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE405849-5D
Data at Wheat_SNP
BE405849-5D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>G;A>G;C>T;A>C;A>G;A>G;A>T;C>T;C>T at 124;129;136;140;191;230;238;242;260
Reference sequence TGCAAGAAGGGAAGGCTGTTACAATCCTCAGGAGGTTCTGAATTTCCTGAAGAAGGTCGGCTTCTCTGCTAATACAACCATCTACTTGACAGAGACATGGTGGCACAAAGGCCTGAATAATCTTAAGAAGGCATTCCCAAACACTTATACCAAGGCAAGTAACTCATCCAGTACCATTTAATTAGTGCGCATCATATTCTGTTTTCTCTTGACCAGATTTTTAACTTACAATCTGTCATCGCGCAGGACGACATAATGCCGGCTGAGAAGAAAGGTGAGTTCCTGAACTCTGGCGATTCAGACCTAGCAAGGGCCCTGGACCTCGAGATCTGCTCGCAGAGCGACGTGTTCGTCCCTGTCATCCCCGGCATGTTCTA
Type
EST
SNP
Sequence
NSFT03P2_Contig15877
Linkage Group
5D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01