Query (optional)   in Class  

GrainGenes Probe Report: BE406580-4D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE406580-4D
Data at Wheat_SNP
BE406580-4D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C at 377
SNP G>A;C>T at 292;417
SNP G>A at 252
Reference sequence CTCCGCATTGGTCTCTATGAGCCAGTGAGTTTCCCTTCCCTCCCTTTTCCCCTTCTCCATGTATATGTATGGTATTGCATTGCGTCAGTAGTCGTAGTGGCACGCAACAATGAACTTGACCCGGATTGTTGTGCCTGACCACCTTCAGGTCAAATCCTTCTATGTTGGTGAGAACCATGTTGGGGATGTACCTTTGTCCAAGAAGATAGCCGCTGGCTTCACCACTGGTACCCTCATCTTTGGATTCTCAAATCAATTTTCCCTTCCATGTGAAATGAAGTATGCAGCAACGTAACATGGTGTGTCCGACTTGCTTCAGGTGCCCTTGCAATCGCTGTGGCCAACCCCACTGACCTTGTCAAAGTCAGGCTTCAGTCTGAGGGGAAGCTGGCACCTGGTGTGCCGCGCCGTTATACCGGGGCAATGG
Reference sequence TCCCTTTTCCCCTTCTCCATGTATATGTATGGTATTGCATTGCGTCAGTAGTCGTAGTGGCACGCAACAATGAACTTGACCCGGATTGTTGTGCCTGACCACCTTCAGGTCAAATCCTTCTATGTTGGTGAGAACCATGTTGGGGATGTACCTTTGTCCAAGAAGATAGCCGCTGGCTTCACCACTGGTACCCTCATCTTTGGATTCTCAAATCAATTTTCCCTTCCATGTGAAATGAAGTATGCAGCAACGTAACATGGTGTGTCCGACTTGCTTCAGGTGCCCTTGCAATCGCTGTGGCCAACCCCACTGACCTTGTCAAAGTCAGGCTTCAGTCTGAGGGGAAGCTGGCACCTGGTGTGCCGCGCCGTTATACTGGGGCAATGGATGCT
Type
EST
SNP
PCR primers
BE406580_cpR1 CTTGGCATAAGCATCCATTG
BE406580D_F1 CCTCCCTTTTCCCCTTCT
Sequence
NSFT03P2_Contig18050
Linkage Group
4D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01