Query (optional)   in Class  

GrainGenes Probe Report: BE422567-4A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE422567-4A
Data at Wheat_SNP
BE422567-4A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>C at 350
SNP G>C at 111
Reference sequence CATAGTGCAGGGTCGATCCTCCAAGTCAACCAAAGTTGGAGATATCATGACCGAAGAGGTACGCTCATACCATGTTCTCAATTTTTTTCAGGGATGTTCTGATTTTCTCTGTGCCCCGTACACCCTGAATAAAATTAGTACAAAAACTCTAGTCATAAGCATGTGAATCACAATTATGTGAACGCGCCGAGCTTCATTGACAAAGCATCATTTTGACAGAACAAGCTGATCACGGTGAAACCTGAAACCAGAGTCCTGAAAGCAATGCAGCTGATGACAGGTAAGCCCGCCTGATCGAGTTCATTCGTCGTTGCACACCAGATGTTCTGTAAAGCACTGAACCCTAACCATGGCACGGCGTGCAGAAAAGCGTATCAGGCACATCCCGGTGATCAGCGGCACGGAGATGAT
Type
EST
SNP
PCR primers
BE422567A_R1 AGACCATCCCCATCATCTCC
BE422567_cpF4 cggaaaatcatagtgcagggtcga
Sequence
unknown
Linkage Group
4A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01