Query (optional)   in Class  

GrainGenes Probe Report: BE424593-4B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE424593-4B
Data at Wheat_SNP
BE424593-4B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A at 107
SNP INS;G>A at 81,1;107
Reference sequence TTATCCAAGTGCGTCCAGATTGCGCGACTCTATTTGGAGGTTAGTGCTGTTTAGCCTTTGTTGTCATTGGCTCATTTGCATGTCAGCTAGACTAATGTAGTTCTTAGTTTTGTAGGATGATGATGCAGTGAATGCTGAAGCTTTTATCAACAAAGCCTCGTTTTTGGTCACAAACAGCAACCAGGAAGTTCTGAACTTACAGTACAAGGTTTGTTGGTTCAGAAACAGTCTAACAATCTATCTGTCTACAACCAAGGACAACAATTTAGTTCCCTTCTTATATCTCTTATAGGTCTGCTATGCGAGAATTTTAGATCTAAAACGTAAATTCTTGGAAGCTGCACTTCGATACTATGGTATCTCTCAGATTGAGCAACGCCAAATTGGGGATGAGTAAGGCTTACTCCCTTTTAATCTTCTGTCTTCTATGGTCCTTTGTTGCCTTGCTGGTGTAGTGGTGCCTAATCTCTACTTTACACACTTGCTATTTCAATATTTTGCTCATTGTATGAAATAAATTACCCTACTTGACACTCATGTTTAGATACTGCAGTGGTTATTGGCTAGTTGTGTTTGGAACTGATATTGCTTCCATATTTTATTCTCAAAAATCTTGATGGAACATTGTTTCTGTATTTTCTCAGAGAGATTGATGAAAATGCTCTTGAGCAAGCTCTTAGTGCTGCTGTAACATGCACAATATTGGCTGGTGCTGGCCCACA
Type
EST
SNP
PCR primers
BE424593A_F1 GGGAAATCTGTCCATCTGCTA
BE424593_cpR1 AGCAAGAACACGAGAGCGTT
Sequence
NSFT03P2_Contig15679
Linkage Group
4B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01