Query (optional)   in Class  

GrainGenes Probe Report: BE424601-A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE424601-A
Data at Wheat_SNP
BE424601-A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>A;C>T;T>G;INS;G>A;A>C;A>T;C>T;C>A at 37;38;42;42,1;45;77;79;241;382
Reference sequence GGCACGCCTCCACGCTAATGACACAATCACGAACCCCCTTATTCGCACGCGACACACGTACACACACATGCAATGGACACATCACTTGGCGCTGAACCCAGAGAAGAAGCGGTTGATGGCGGGGAAGACCTCCGGGCGGTGCGCGCTGACGAAGCGGCGGAAGGCGTGCTGGCTGTACCTCTCGCCCTCCTCCTCGTTCTCCGGCACCGCGCTCTGCCGGTTGCTCTTGCTCACCCTGAACAAAGCAAGAGAGCAAAACGGTTAACCACATGCATGCATCGAAATTCGAAATGATCCGATCGATCGATCGGGGCGGCTTGGAGGCCTCACCTGACGTCCGGGTTGAGGAAGACGTTCCGGGTGAGCTGGAAGACGCACATCCCCGTCACCAGCGACATGGCGCCGATCAGCGGGTAAACCTGCACCACCACCAGGATCGTTAAGGCAAGATACAAAAATAACTCTGAAGTAATCGAACGGTCTTGCACGTACATCTGGCTTCAACCAACGGCCCATGTCGTCGCCTGGCCTA
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01