Query (optional)   in Class  

GrainGenes Probe Report: BE424826-7B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE424826-7B
Data at Wheat_SNP
BE424826-7B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>C at 843
SNP T>C;G>C;A>C;INS;G>A at 123;182;362;456,1;731
SNP T>G at 654
Reference sequence GGACCACATTTAACTGTAACACACATCAATATTGATGAACTGATTGGGGTAAATGTGAATAGAACAGTTTCATATGGCAACTAAAACATGGTATCATGATATGTTAGCTGAGAATACTCAAGGAGGTTAGTTCAATGACAAGTAGAAATAATGAAATAGAGCATTTTAGTTCGGGATTGAGTAGGATCAAAGGGTATCCAGGTATGCCATCTGAGGCAGGCGGCACATTAAGATCAAAGTAGTTTCCATGATAAGTGACTGGTTCAAATCACAGATATCCAAACTAGCCCTAATTTAACCAACCCTAACAACAAGAAAGCAGCTTTATTCATGACCTGAATGAACTACGCTTAAGCATTGTTCCTACAATTCAAGAGCAGAATAAAAACTGATTGTACACAAACCATTGGAAAATCTTATCGAACAAGCAACTGTGCTGAGCTGATCTGGTTTAACCTTCTTAGGTGGGGCAAGCAAATCATTTAACTGTCCATGGGCGTAGCTAAATTGTCATAGAGCTAACAAACAACATGAATTGGATTACAACTAGTTGCATGAGTAGGTTGCAAATGGAATGTTATGGTACAGCTCTCTTAGTATGTAAGCTCTCGGCTTATGCATCAACGAGACCGGAGAATAAAAGCTAGTAACTCATAATAACAACTGGATCACAGTACAGCTAGCAGTAATCCAAACTGAAAAATGGAGCGTGATAGTACAGCTCTATGAGTATACACCTCTCAGCTCACGTCTGAACGAGATTAGAGAAGTATGACAGGGCACATTCTATAATAAGTTGATACAGACACAGCGGCATCAGGAAATTGTTCAATCTCTTCGGAACAGGACGTGAGAGAACAGCGAGCACGATCTTGGCACCGC
Reference sequence CGCCTCCATGGCTGGTATGCACCCCCCCGGCCCTGCTACTTCTGCTCACCGGTCCGGTCCCGCTACAAGATCTGACTCGATTGTTCACGCCGTCCTGCTGTATTCATGCCACGAACATCAATTAGTAGCTAGATTTCGATTTGCGGTGCCTAAGATCGTGCTCGCTGTCCTCTCACGTCTTGGTCCGAATAGATTGAACAATTTCCTGATGCTGCTTTGTCTGTTATCAACTTATTATAGAATTTGCCCTGTCATACTTCTCTAATCTCGTTTAGACGTGAGCTGAGAGGTGTATACTCATAGAGCTGTACTATCACGCTCCATTTTTCAGTTTGGATTACTGCTAGCTGTACTGTGATCCAGTTGTTATTATGAGTTACTAGCTTTTATTCTCCGGTCTCGTTGATGCATAAGCCGAGAGCTTACATACTAAGAGAGTTGTACCATAACATTCCATAGCCTCATGCAACTAGTTGTAATCCAATTCATGTTGTTTGTTAGCTCTATGACAATTTAGCTGCGCCCATGGACAGTTAAATGATTTGCCTGCCCCACCTAAGAAGGTTGAACCAGATCAGCTCAGCACAGTTGCTTGTTCGATAAGATTTTCCAATGGTTTGTGTACAATCAGTTTTTATTCTGCTCTTGAATTGTAGGAACAATGCTTAAGCGTAGTTCATTCAGGTCATGAATAAAGCTGCTTTCTTGTTGTTAGGGTTGGTTAAATTAGGGCTAGTTTGGATATCAGTGATTTGAACCAGTCACTTATCATGGAAACTACTTTGATCTTAATGTGCCGCC
Type
EST
SNP
PCR primers
BE424826B_R3 TGAGTAGGATCAAAGGCTAT
BE424826_cpF1 TACACCGTCAACCTCCACAA
Sequence
NSFT03P2_Contig14778
Linkage Group
7B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01