Query (optional)   in Class  

GrainGenes Probe Report: BE426214-6D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE426214-6D
Data at Wheat_SNP
BE426214-6D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>T;T>G;C>A;INS;T>G;T>A;INS;T>C at 404;431;446;690,1;720;721;770,2;776
SNP C>T;C>T;INS;A>T;A>C;INS;T>C at 105;162;382,2;431;432;461,1;620
SNP C>T;G>A;A>G;INS;A>T;A>C;INS;G>T at 162;237;376;382,2;431;432;461,1;706
Reference sequence GTGTTCGTGCTCGCAACATCTGCCCTTCTGTGCCATCCTATGAGAGGCGCTTCACCACAAGCAGCTACATGACTCAGAACCTTGGCATCAGTGTCCCAATGATGTCATCTTCTCCATTGTTTGCCAATGCACCCCCTGAGAAGAAAGGTGTCAAGAACTTTGCGATTGACTTCCTCATGGGAGGAGTGTCAGCTGCAGTTTCCAAGACTGCTGCAGCTCCTATTGAGCGTGTTAAGCTGCTTATCCAGAACCAGGATGAGATGATCAAGGCTGGCAGGCTCTCTGAGCCATACAAGGGTATTGGTGACTGCTTTGGGCGCACCATCAAGGATGAAGGCTTTGGCTCACTGTGGAGAGGAAACACTGCTAACGTCATCCGTTACTTCCCAACTCAGGTATCCATATGTTGTTGTTTTTGTTGTGCTTATTTTCATTAGCTTTCATGCTCACATGATGGTAATGGTGTATGTTGAATGCCTATTCTCAGTCTTTGAACTTCACATGAAATGTGGCATTTAACAATCTGGCTGTAATGTTATTTGTGATGATGCTCTTGATGGTAGTCTAATAAACATCTATCATCTGTTTGTCTTCTGTTTTTGAATGCCTAGTTTTACAGCTGATGCACTTTAGGAGATAGAATTGAATATCTCTATTGTATCCAGAAATTGTGGTTCAAATATTTCATTTCATACAGCTTATGCTAGTTTTATGTACCATTATTATTCTTTTGCTATTGTTTTCTTGTTCTAACTTGATCTAATTCATTTGTCTTTTTCCTAGGCTTTGAACTTTGCATT
Reference sequence AGTGCCAGTGGAGGAGAACTGGGCTTCAGAGAGTCATACAGTCCAAAGTACAGACCACGGTAGACAATGATTCCAACACAGGAGATGTTGAATCCACGGTAAAGCCCAGCAATACCATCTGACTTGAGAGTCTTGCGGTAGACATCAACCAGGCCATTGAACTGCCTCTCACCTCCACCCTTGGATGCCTTTGCGTCATTGGCCAGCCTTGTCCTAGCATAGTCAAGGGAGTACACGAAGAACAGCGAGGAAGCACCAGCTGCACCACCAGAAGCAAGGTTGCCACCGAACCACTTCCAGTAACCATCCTTGTCCTTCTTGAAGTTGAACATCCTCTTGAAGTAATCCTTGAATGCAAAGTTCAAAGCCTAGGAAAAAGACAAATGAATTAGATCAAGTTAGAACAAGAAAACAATAGCAAAAGAATAATAATGGTACATAAAACTAGCATAAGCTGTATGAAATGAAATATTTGAACCACAATTTCTGGATACAATAGAGATATTCAATTCTATCTCCTAAAGTGCATCAGCTGTAAAACTAGGCATTCAAAAACAGAAGACAAACAGATGATAGATGTTTATTAGACTACCATCAAGAGCATCATCACAAATAACATTACAGCCAGATTGTTAAATGCCACATTTCATGTGAAGTTCAAAGACTGAGAATAGGCATTCAACATACACCATTACCATCATGTGAGCATGAAAGCTAATG
Type
EST
SNP
Sequence
NSFT03P2_Contig18762
Linkage Group
6D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01