Query (optional)   in Class  

GrainGenes Probe Report: BE426287-3D

[ Printable Version ]  [ Submit comment/correction ]

Data at Wheat_SNP
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL;T>G at 107-108;402
[ Show all 7 ]
PCR primers
BE426287_cpF2 tgcattctcgcgccggtttc
Linkage Group
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01