Query (optional)   in Class  

GrainGenes Probe Report: BE435260-B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE435260-B
Data at Wheat_SNP
BE435260-B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>C;C>G;A>C at 183;305;306
Reference sequence TTAACATGGGTTACAATCATCATGCAACAGGAGGAAAACAGGGAATGAGGAATACTTGTATTGAAAAAGAAAGAAAAGAAAGGAAAACAGTACTCATGCGATTTAATAATAGAAATGCTATGTGGAACTGTCATATACAAGAACTGAGAATTACAGCACTACATAATACAAGTTAGAGAATTAATGCCTAATACGTGCTATAATCAAGGGTTAACAAAACAATCATCGGCAACTGTAACACACCTTATCAATTATGTTCTCTATAATTTCATCAGACAGATTCATTCCTGACTCCGAAAGTGTGCAAACAACCATC
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01