Query (optional)   in Class  

GrainGenes Probe Report: BE442574-6D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE442574-6D
Data at Wheat_SNP
BE442574-6D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;A>G;C>T;C>G;A>T;A>T at 185;263;306;407;426;427
SNP A>G;C>T;C>G;A>T;A>T at 263;306;407;426;427
SNP T>C;A>G;C>T;G>A;C>G;A>T;A>T at 170;263;306;373;407;426;427
Reference sequence GATGATGAACAGAAGGTATGGAAAAGGCAAACTAGATCGTCTTTCTAGAAGTTTCGACATTCGAATGTTATCCTTGGTTCAGAGAGCTGGTTTCTTCCATGAAAATAAACTAATTTTCTGTTTGCCTTTTCAAGGTCGGTGCTGAAATTGTGAGGAAATCCTTGAGCTATCCACTTAAACTGATCGCGAAAAATGCTGGTGTCAATGGCAGTGTGGTCACTGAGAAGGTTTGGACTGAAGTTTGTTTTCAAATCTGAATTTAATATGTAGTACCTTGTGTGTAACTAATTTGGGGCTTGTCTATACTCAGGTCCTTGTGAATGACAACTTCAGGTACGGCTACAATGCCGCTACAGGGAAGTATGAGGATTTGATGGCTGCTGGTATTATTGATCCCACCAAGGTACGAGCAAATTGTGTTTACGAATTTTGTGTTGTCTCAGAACATTTTTCTCTCAAACTAAAATATTTCTTTGCAACAATTATATTATGCAAGAAGCGAAAAT
Type
EST
SNP
PCR primers
BE442574_cpF1 gaacccttgagaatgatgaacagaa
BE442574D_R1 TTTAGGTACAGAGGGAGTCG
Linkage Group
6D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01