Query (optional)   in Class  

GrainGenes Probe Report: BE442574-D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE442574-D
Data at Wheat_SNP
BE442574-D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP INS;T>C;A>G;C>T;G>A;C>G;A>T;A>T;INS;C>T;DEL at 10,1;133;226;269;336;370;389;390;588,1;734;740
Reference sequence TCGTCTTTCTGAAGTTTCGACATTCGAATGTTATCCTTGGTTCAGAGAGCTGGTTTCTTCCATGAAAATAAACTAATTTTCTGTTTGCCTTTTCAAGGTCGGTGCTGAAATTGTGAGGAAATCCTTGAGCTATCCACTTAAACTGATCGCGAAAAATGCTGGTGTCAATGGCAGTGTGGTCACTGAGAAGGTTTGGACTGAAGTTTGTTTTCAAATCTGAATTTAATATGTAGTACCTTGTGTGTAACTAATTTGGGGCTTGTCTATACTCAGGTCCTTGTGAATGACAACTTCAGGTACGGCTACAATGCCGCTACAGGGAAGTATGAGGATTTGATGGCTGCTGGTATTATTGATCCCACCAAGGTACGAGCAAATTGTGTTTACGAATTTTGTGTTGTCTCAGAACATTTTTCTCTCAAACTAAAATATTTCTTTGCAACAATTATATTATGCAAGTAAGCGAAAATTATTAAAAACAAACCCCAAGTCTACGACTCCCTCTGTACCTAAATACGTATGAGAAAACTTCTTATATTTAGAAACAGAGGTTAGTATTATACTTTGCTGGGAAATGACTACATTGAGTGTTTTTTATTTACGCCGTCAGCCTTATTATGTGCAATCATACTGAACCATTAAGCATGATCACCCATAGACTCAAGGAATAACCAGTTTGAGAGACATGGTGTGGCAGGGGTTCTGTCCCTGGAATATTTGTCTCCACCCTCCTCTCTCTTCACAAGCAGTGGGCCCATAAGCTAACCTGATTTCTCGC
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01