Query (optional)   in Class  

GrainGenes Probe Report: BE442619-7B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE442619-7B
Data at Wheat_SNP
BE442619-7B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL;T>G;G>T;T>G;G>T at 25;900;901;902;904
SNP A>G at 369
SNP T>C;A>G at 328;369
Reference sequence GGGTTCTTGGCAAAATGGAAGGTTGGTTTAGCTCTCCATTTATTGATATGGTTTTCCTTTCTGTTTTGTTTTACTTAAACCCATGCAACTGGAATTGATACATCATTGTATTTACATTTTCTAATGCCTTCAACAGACAATTCTTAGAGGTCACTTGAGATGCTTTCCCATTTTTCAGTTGCCAAATAGATGGCTTGATTGAATGGATCTTGTCATTGAGCTTCCATTTAGCATCCACTGGCTTTCCCAAAGCACTGTTATGTTTCCCACTTTGACCAGGTGCACCAGAATGCTTTGGATAAACCTTTTTATTTTTGAACACATGCTTTGGATAAAACTTGATTCCAAAAGCATTTGATAGGTCCAATAGCTGAAAGACAACCTGGTATAGAGCTCTGGTATATTTTGTTTGTCCAATGGCAATAGCTTGGATATATTAAGATTGGTATGATGATATCCATCATGAACCTAGATGACAGTTAATTCATACTTTCTGCATCTGACTGTGCATAGCTCGATTGATTAATATATACACGATTGCATGTATCTATGTCACTATGTTAGTGTCCTGGTTGAAATGGCCGATCGTTTTGATATATTATTGTATGTTATGGCCCATTGGAGCCTGGAAATT
Reference sequence AAGGTTCGTTTACTCTCCTTTTATTGATATAGTTTTCCTTTCTGTTTTGTTTTAGTTAGACCCATGCAACTGGAATTGATACATAATTGTATTTACATTTTCTAATGCCTTCAACAGACAATTCTTAGAGGGCACTTGAGATGCTTTCCCAAATTTTCAGTTGCCAAATACTCCCTCCGTCCCAAAATAAGTGTCGTTGATTTAGTAAGTACAACTTTGTACTAAATCAACAACACTTATTTTGAGGCGGAGAGATAGATGACTTGATTGAATGGATCTTGTAGTTAAGCTCCCATTTAGGATCCACTGGCTTTCCCAAAGAACTGTTTTTTTTTCTCACTTTGACCAGGTGCACCTGAATGCTTTGGGAACCTTTTCATTTTTTAACACATGCTTTGGATAAAACTTGATTCCAAAAGCATTGGATAGGAATATAATGCAATAAAAGCTAAAAGACAGCCTCCTTACAGGCATATGGCTCTGGTATATTTTGTTGGTCTAATGGCAACAGCTTGGATATAGTAAGATTGGTGATGTCAACCATCATGAACCGAGATGACAGTTAATTCATACTTTCTGCATCTGATTGTGCATAGCTCGATTGATTAATATATACACCAATACATGTATCTATGTCACTATGTTAGTTTTCTGGTTGAAATGGCTCATCGTTTAGCTATATTGTTATATGTTAGGGCCCATTTGGAACCTGGAAATTTCTCACCACTTTTGTGTGATTTATTATCGCTGTGTGTGAATTGAACCATGGTTTCCTGTGGGAGTTTGAATGCTCTTCAAGGCGTCCTATTCTTTATGCATTTGTGCAAGCATTGATTCTTTCCAAGGAAAGGGGAATTGTTACATTGCAAACAGGTTTTGGTGTTGAATCTAAAAACTTTTGTGGTTCTTCAGGT
Type
EST
SNP
PCR primers
BE442619B_R2 ATAGCTCAATTCATACACAGCA
BE442619_cpF1 GTTGAACTCAGGGTTGGCAT
Sequence
NSFT03P2_Contig1785
Linkage Group
7B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01