Query (optional)   in Class  

GrainGenes Probe Report: BE442619-7D

Probe
BE442619-7D
Data at Wheat_SNP
BE442619-7D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL;INS;C>T;DEL;INS;T>G at 7;35,1;38;390;861,1;885
Reference sequence TGGCAAATGGAAGGTTGTTATAACTCTCGTTTTATCACATAGTCTTCCTTTCTGTTTTGTTTTAGTTAAACCCATGCAACTGGAATTGATACATAATTGTATTTACATTTTCTAATGCCTTCAACAGACAATTCATAGAGGGCACTTGAGATGCTTTCCCAATTTTTCAGTTGCCAAATACTCCCTCCGTCCCAAAATAAGTGTCGTTGCTTTAGTACTGTACAACTTTGTACTAAATCAACAACACTTATTTTTGAGACAGAGAGATAGATGGCTTGATTGAATGGATCTTGTAGTTAAGCTCCCATTTAGGATCCACTGGCTTTCCCAAAGCACTGTTTTTTTCCCACTTTGACCAGGTGCACCTGAATGCTTTGGACAAACCTTTTTATTTTTGAACACATGCTTTGGATTAAACTTGATTCCAAAAGCATTGGATAGGAATATAATACAATAAAAGCTAAAAGACAGCCTCCTTACAGGCATACGGCTCAGGTATATTTTGTTGGTCTAATGGCAACAGCTTGGATATAGTAAGATTGGTGATGGTATTCATCATGAACCGAGATGACAGTTAATTCATACTTTCTGCATCTGATTGTGCATAGCTCGATTGATTAATATATACACCAATACATGTATCTATGTCACTATGTTAGTTTTCTGGTTGAAATGGCTCATCGTTTAGCTATATTGTTATATTTTAGGGCCCATTTGGAACCTGGAAATTTCTCACCACTTTTGTGTGATTTATTATCGCTGTGTGTGAATTGAACCATGATTTCCTGTGGGAGTTTGAATGCTCTTCAAGGCGTCCTCTTTATGCATTTGTGCAAGCATTGATTCTTTCCAAGGAAAGGGAATTGTTACATTGCAAACAGGTTTTGGCGTTGAATCTAAAAACTTTTGTGGTTCTTCAGGGTGAGT
Reference sequence GCTTTGGATTAAACTTGATTCCAAAAGCATTGGATAGGAATATAATACAATAAAAGCTAAAAGACAGCCTCCTTACAGGCATACGGCTCAGGTATATTTTGTTGGTCTAATGGCAACAGCTTGGATATAGTAAGATTGGTGATGGTATTCATCATGAACCGAGATGACAGTTAATTCATACTTTCTGCATCTGATTGTGCATAGCTCGATTGATTAATATATACACCAATACATGTATCTATGTCACTATGTTAGTTTTCTGGTTGAAATGGCTCATCGTTTAGCTATATTGTTATATTTTAGGGCCCATTTGGAACCTGGAAATTTCTCACCACTTTTGTGTGATTTATTATCGCTGTGTGTGAATTGAACCATGATTTCCTGTGGGAGTTTGAATGCTCTTCAAGGCGTCCTCTTTATGCATTTGTGCAAGCATTGATTCTTTCCAAGGAAAGGGAATTGTTACATTGCAAACAGGTTTTGGCGTTGAATCTAAAAACTTTTGTGGTTTCTTCAGGTGTTGAGTCCTTCGATGTAGACATCAAGGAGCAGAAGGTCACTGTGAAGGGTAA
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01