Query (optional)   in Class  

GrainGenes Probe Report: BE442638-3D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE442638-3D
Data at Wheat_SNP
BE442638-3D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C;T>C;T>G;INS;C>T;A>T;A>T;C>T;T>G;A>G;A>C;T>C;A>G;T>G at 65;75;82;89,1;90;91;92;93;104;108;119;251;302;311
Reference sequence GATTGGGCCTAATTTACGGGTTTTTGTTTCTCTTAGTTCGCTTCTTCTTTTCGTTTACTTTTAGTTTCTTTGTGTGATTTCTAAGCTTCCAACTTTTCTCAGTTTCAAATCTCTGTACAGTGTTTGTAAAGGATGTATGCTGGTGCAAAATCTTCCAATCCGGCTGTGACAAATCTTCCTTGGACAGCCCGGCCACCTTTTGCACATAAGGATGGGCTACGTGTGTTAAACATTAGTGGCGCAGTGCTCGTTTCACTCAGCTATGGAGGCTTGGAGTTCGTCAGATTCCAATCCTCCTAGTAAAGCAAGCTCACATCTTCCCCCTTTTTTCTTCCCAGTCTCCACATGGTTTTGTGTTTTGGAAAAGAGAAACGAGATTTTCCCTGCTTCCGATTGCTTGGTTTGCTGTCTTGTGTTGACGGAGACATTTGGATCTGCAAGTTTTCATTTTGGTGATGTTAAAACGAGCCAGATCGNCCAGTCCTT
Type
EST
SNP
Sequence
WHE1101_E09_I17ZS
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01