Query (optional)   in Class  

GrainGenes Probe Report: BE442892-5D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE442892-5D
Data at Wheat_SNP
BE442892-5D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G;A>G;C>T at 23;216;420
SNP A>G;A>G;C>T at 96;289;493
Reference sequence AGAGGCAAGCAACCAAGCTTTCATGTTTTTGATAAAGTGGTGTTTTTGTACAGAGCATGAATTACAATAGTTTAACCTTTTCACGCCACACTATTATTTCTTAGTTTCTGATTGCCCCATCGTATACTGTGCATAAAGCCTGCAGGATTTGACTCTTGAATTTCCTTGTTTACATTGTTTTCACGTTTCCTATTTTCAGTGAATATCTAGTTACAATCCTGATGTGATATATTCTAATATTCTATAAATACTTTCGAATAGACAATGGCTTGATTGCTTTGGTACCTGTACCTAACTTCCCACTATAATCCGTAACTGTGCTAGCGGTATTTAGTATCCAGTCTGAACACTAGTATCATTATGGGAATATGCTACCAGACTATGCATTCATGAATGTTATTATCTGCTCATGTAGTAGTCCTACATGAATTGACCGATAACCATACAAATTATGACATCTTTATTAAATCTCTTATCAAGACCTCGCTTCTATTTTGTTTATCTCTGACTTTGTTCTCTTTCTTTGGTACTTGTCATTTTTTTTTCTGAACAATGTTAATTCAGGTGTTGAGGAAGTCCATGAAAGGTCTAGGTACTGATGACAAGACACTTGTAAGGGTTGTGGTAACAAGGACTGAGATTGATATGCAGTATATCAAGGCAGAATATTACAAGAAATACAAAAAGCCGTTGGCTGATGCTATCCATTCCGAAACATCAGGCGGTTATCGGACGTTCCTGCT
Reference sequence GAAGTATTTTGCTAAGGTATCTCACCCGTGCTGTCCTCCAAAAAGAATATGTAAACTTCTTTATTTGATATCAAGAGGCAAGCAACCAAGCTTTCATGTTTTTGATAAAGTGGTGTTTTTGTACAGAGCATGAATTACAATAGTTTAACCTTTTCACGCCACACTATTATTTCTTAGTTTCTGATTGCCCCATCGTATACTGTGCATAAAGCCTGCAGGATTTGACTCTTGAATTTCCTTGTTTACATTGTTTTCACGTTTCCTATTTTCAGTGAATATCTAGTTACAATCCTGATGTGATATATTCTAATATTCTATAAATACTTTCGAATAGACAATGGCTTGATTGCTTTGGTACCTGTACCTAACTTCCCACTATAATCCGTAACTGTGCTAGCGGTATTTAGTATCCAGTCTGAACACTAGTATCATTATGGGAATATGCTACCAGACTATGCATTCATGAATGTTATTATCTGCTCATGTAGTAGTCCTACATGAATTGACCGATAACCATACAAATTATGACATCTTTATTAAATCTCTTATCAAGACCTCGCTTCTATTTTGTTTATCTCTGACTTTGTTCTCTTTCTTTGGTACTTGTCATTTTTTTTTCTGAACAATGTTAATTCAGGTGTTGAGGAAGTCCATGAAAGGTCTAGGTACTGATGACAAGACACTTGTAAGGGTTGTGGTAACAAGGACTGAGATTGATATGCAGTATATCAAGGCAGAATATTACAAGAAATACAAAAAGCCGTTGGCTGATGCTATCCATTCCGAAACATCAGGCGGTTATCGGACGTCCTG
Type
EST
SNP
Sequence
NSFT03P2_Contig11688
Linkage Group
5D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01