Query (optional)   in Class  

GrainGenes Probe Report: BE442982-7A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE442982-7A
Data at Wheat_SNP
BE442982-7A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;A>T;T>C;G>C at 16;32;38;410
SNP G>A at 276
Reference sequence TGGGGAATGAAGTCGGTAAGAAGGTAAGGACCTAACTTTTTGTCTGATTTGTTTTTCATCATCTCTTCTATTTCTGAAATTACATATGATATAATGTGTAGATAAATTTGCGGTCAGCACAAACAAATTTAGCATTCCGAAAGCTCTTTAACCTCCCTCCTGAAGAATTCCTCATCGATGATTTCACCTGTCATCTAAAACGGAAGATGCCACTTCAGGTATTTACTTTTCTGATTGTTTACTTATGTGTCAAAGATGCTACTATTATTTTAATTGTACCAAGTAGACCTGTACATGTATGTACCATACTACCAAGGAGAATCGTTTTGCA
Reference sequence AAGAAGGTAAGGACCCAACTTTTTGTCTGATATGTTTTTCATCATCTCTTCTATTTCTGAAATTACATATGATATAATGTGTAGATAAATTTGCGGTCAGCACAAACAAATTTAGCATTCCGAAAGCTCTTTAACCTCCCTCCTGAAGAATTCCTCATCGATGATTTCACCTGTCATCTAAAACGGAAGATGCCACTTCAGGTATTTACTTTTCTGATTGTTTACTTATGTGTCAAAGATGCTACTATTATTTTAATTGTACCAAGTAGACCTGTACATGTATGTACCATACTACCAAGGAGAATCGTTTTGCATTCGTTTGTGACTCACTTGACAGTTGCCAATATTTTGTACTTTCTCCATTTTGTTCTGTCAATATTTACAGAGAACTGACTCTTTTACAGGGACGGGTATTTTTTTCTCCAAGAATAATTGGATTCTACTCTAATATATTTGGTCACAAGACCAAGTTTTTCTTTCTGTGGGAAGACGTTGATGATATCCAGGTTATCCCTCCTACACTGTCAATTGGCAGCCCATCCTTGATGGTTATCCTTAGAAAGGATAGAGGGTCAGAAGC
Type
EST
SNP
PCR primers
BE442982A_R1 GTCACAAACGAATGCAAAACG
BE442982_cpF1 TGGGGAATGAAGTCGGTAAG
Sequence
-
Linkage Group
7A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01