Query (optional)   in Class  

GrainGenes Probe Report: BE442982-7D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE442982-7D
Data at Wheat_SNP
BE442982-7D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G;G>T at 280;347
SNP T>C;A>G;G>T at 70;280;347
SNP A>G;G>T at 272;339
Reference sequence GTCGGTAAGAAGGTAAGGACCTAACTTTTTGTCTGATTTGTTTTTCATCATCTCTTCTATTTCTGAAATTACATATGACATAATGTGTAGATAAATTTGCGGTCAGCACAAACAAATTTAGCATTCCGAAAGCTCTTTAACCTCCCTCCTGAAGAGTTCCTCATTGATGATTTCACCTGTCATCTAAAACGGAAGATGCCACTTCAGGTATTTACTTTTCTGATTGTTTACTTATGTGTCAAAGATGCTACTATTATTTTAATTGTACCAAGTAGACCTATACATGTATGTACCATACTACCAAGGAGAATCACCGCTATAGTTTTGCATTCGTTTGTGACTCACTGGACATTTGCCAATATTTTGTACTTTCTCCATTTTGTTCTGTCAATATTTACAGAGAATTGACTCTTTTACAGGGACGCGTATTTTTCTCTCCAAGAATAATTGGATTCTACTCTAATATATTTGGTCATAAGACCAA
Reference sequence GAAGGTAAGGACCTAACTTTTTGTCTGATTTGTTTTTCATCATCTCTTCTATTTCTGAAATTACATATGACATAATGTGTAGATAAATTTGCGGTCAGCACAAACAAATTTAGCATTCCGAAAGCTCTTTAACCTCCCTCCTGAAGAGTTCCTCATTGATGATTTCACCTGTCATCTAAAACGGAAGATGCCACTTCAGGTATTTACTTTTCTGATTGTTTACTTATGTGTCAAAGATGCTACTATTATTTTAATTGTACCAAGTAGACCTATACATGTATGTACCATACTACCAAGGAGAATCACCGCTATAGTTTTGCATTCGTTTGTGACTCACTGGACATTTGCCAATATTTTGTACTTTCTCCATTTTGTTCTGTCAATATTTACAGAGAATTGACTCTTTTACAGGGACGCGTATTTTTCTCTCCAAGAATAATTGGATTCTACTCTAATATATTTGGTCATAAGACCAAGTTTTTCTTTCTGTGGGAAGACGTTGATGATATCCAGGTTATCCCTCCTACACTGTCAATTGGCAGCCCATCCTTGATGGTTATCCTTAGAAAGGATAGAGGGTC
Type
EST
SNP
PCR primers
BE442982_cpF1 TGGGGAATGAAGTCGGTAAG
BE442982D_R1 GAAAGAAAAACTTGGTCTTA
Sequence
-
Linkage Group
7D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01