Query (optional)   in Class  

GrainGenes Probe Report: BE443160-2A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE443160-2A
Data at Wheat_SNP
BE443160-2A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;A>T;T>G;G>A;A>G;A>G;A>C;A>C;G>T;C>T;T>G;C>T;G>A;C>T;G>C;C>T;C>T at 44;47;48;49;50;51;83;84;85;87;91;96;135;287;353;416;458
Reference sequence TGGCTGTGACTAACTTTTGAAGTAGGTGATGAGAAAGTCCACGCTTATGAATGGATTCTTGCCGCTCGCTCCCCGGTGTTCAAAGCCCAATTCTTCGGACCTATTGGTAAACCTGACATGGACAGAGTTGTTGTGGAGGATGTTGAACCTATCGTCTTCAAGGTAATTGTTACATGCAGACTGCACCGATTTTTAGTATGTTTTTGTTAGGGAATCCCAGTTCCTCCTTTTTAGGTGTTTTCAGTCATAATGTACATTTTTAGAATCTTTTTTACTCATTTGTGAGCGTTTTCTCTCTGCCCTCTGTTGATTAACACACATGCTGTGTGCACTTGTAATTTAATTCCCACCAGAATAAGTAAGTTAATCCCCGTAAAGTAAGCATGTTTGATCTTGTCTAGTATGAACAATCTAGCTCAATTGTTTGTGTTAGAACCAATCTGGGTCTATTTTGGATCACTAAACTTTTGCTGGCTTGCCTAACATCCAACCTTGAGAAAAAGAAGGAAATCCTTGCAAAATTATTATTTAGTGAAAGACCCCCTTATGGTAATATAATATTACAACTTCTCTTCCAATGCAGGCAATGGTCAATTTCATATATTCTGATGAGCTTCCTAGTATTCATGAAGTAGCTGGATCTTTCTCAATGTGGACATCTACTGCGGTAACACAACATCTGTTGGCAGCAGCTGATAGATATGGGTTGGACCGGCTACGAATCCTATGTGAGGCAAAGTTATGTGATGAACTCACTTCTGAAACAGTAGCGACAACCTTAGCCCTAGCTGAACAGCA
Type
EST
SNP
Sequence
NSFT03P2_Contig9777
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01