Query (optional)   in Class  

GrainGenes Probe Report: BE443160-2D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE443160-2D
Data at Wheat_SNP
BE443160-2D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G at 688
SNP T>C;C>T;C>T;A>G;T>G;A>G;DEL;G>C;C>T;C>A;T>G;T>G;C>T;A>T;A>T;A>G at 40;42;44;45;46;48;80;82;84;85;88;89;156;157;158;676
Reference sequence CTGTGACATAACTTTTGAAGTAGGTGATGAGAAAGTCCCTCCTCATGATGGATTCTTGCCGCTCGCTCCCCGGTGTTCAACGCCCAATTCTTTGGACCTATTGGTAAACCTGACATGGACAGAGTTGTTGTGGAGGATGTTGAACCTATCGTCTTCAAGGTAATTGTTACATGCAGACTGCACCGATTTTTAGTATGTTTTTGTTAGGGAATCCCAGTTCATCCTTTTTAGGTGTTTTCAGTCATAATTTACATTTTTAGAATCTTTTTTACTCATTTGTGAGTGTTTTCTCTCTGCTCTCTGTTGATTAACACACATGCTGTGTGCACTTGTAATTTAATTCCCAGCAGAATAAATAAGTTAATCCCCGTAAAGTAAGCATGTTTGATCTTGTCTATGAACAATCTAGTTCAATTGTTTGTGTTAGAACCAATCTTGGTCTATTTTGGATTACTAAACTTTTGCTGGCTTGCCTAACATCCAACCTTGAGAAAAAGAAGGAAATCCTTGCAAAATTATTATTTAGTGAAAGACCCCCTTATGGTAATATAATATTACAACTTCTCTTCCAATGTAGGCAATGGTCAATTTCATATATTCTGATGAGCTCCCTAGTATTCATGAAGTAGCTGGATCTTTCTCAATGTGGACATCTACTGCGGTAACACAACATCTATTGGCAGCAGCTGATAGATATGGGTTGGACCGGCTACGAATCCTATGTGAGGCAAAGTTATGTGATGAACTCACTTCTGAAACAGTAGCGACAACCTTAGCCCTAGCTGAC
Reference sequence CTCCACATTGGCTGTGACATAACTTTTGAAGTAGGTGATGAGAAAGTCCAGGTACATAAATGGATTCTTGCCGCTCGCTCCCCGGTGTTCAAAGCCCAATTCTTTGGACCTATTGGTAAACCTGACATGGACAGAGTTGTTGTGGAGGATGTTGAACCTATCGTCTTCAAGGTAATTGTTACATGCAGACTGCACCGATTTTTAGTATGTTTTTGTTAGGGAATCCCAGTTCATCCTTTTTAGGTGTTTTCAGTCATAATTTACATTTTTAGAATCTTTTTTACTCATTTGTGAGTGTTTTCTCTCTGCTCTCTGTTGATTAACACACATGCTGTGTGCACTTGTAATTTAATTCCCAGCAGAATAAATAAGTTAATCCCCGTAAAGTAAGCATGTTTGATCTTGTCTATGAACAATCTAGTTCAATTGTTTGTGTTAGAACCAATCTTGGTCTATTTTGGATTACTAAACTTTTGCTGGCTTGCCTAACATCCAACCTTGAGAAAAAGAAGGAAATCCTTGCAAAATTATTATTTAGTGAAAGACCCCCTTATGGTAATATAATATTACAACTTCTCTTCCAATGTAGGCAATGGTCAATTTCATATATTCTGATGAGCTCCCTAGTATTCATGAAGTAGCTGGATCTTTCTCAATGTGGACATCTACTGCGGTAACACAACATCTATTGGCAGCAGCTGATAGATATGGGTTGGACCGGCTACGAATCCTATGTGAGGCAAAGTTATGTGATGAACTCACTTCTGAAACAGTAGCGACAACCTTAGCCCTAGCTGAACAGA
Type
EST
SNP
Sequence
NSFT03P2_Contig9777
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01