Query (optional)   in Class  

GrainGenes Probe Report: BE443190-4D

Probe
BE443190-4D
Data at Wheat_SNP
BE443190-4D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T at 382
SNP C>G at 107
Reference sequence ACACCACCAAAATTCGGCTCCCCAGAACGCCAAAGTGTAATTGACGAGGTAAAATTCCAGACACACTTCAAAGAACTTAAATACGCCCCGTTCTGTTTCTTTGACACAAAGAACTGTTGCAAACACAGATCCATGAGCAAATGCTCAGTAAAGCTCCACCTGTTCCTCAACTGCTGACAATTGGCTCTGAAGAGGAGACTAACAAGACGGCACCCGACACTTCTGGTGAACATGCTGTCAAGGCAGCAGAAGGTGTCAACACTTCTGGCAGCAGCTCTGGTTCTGCTAATGATACTGACCTTCCAAAGCCTGATTCAGAGTCAGAAGTTGCAGAAAACATTGCCAGAGCTCAGGCAGATGTAATCCCCAGGGACAGCGGTCCGAGAGTTGTTACAGCACCGCAGAACCCCGTTGTCACAATC
Type
EST
SNP
PCR primers
BE443190_cpF1 ATCACGTGAAACACCACCAA
BE443190D_R1 TTGGCTTCTGGATTGTGACA
Sequence
NSFT03P2_Contig17015
Linkage Group
4D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01