Query (optional)   in Class  

GrainGenes Probe Report: BE443531-1A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE443531-1A
Data at Wheat_SNP
BE443531-1A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T at 585
SNP C>G at 839
Reference sequence AAGGGAGGCTCACACTTGCTGATGCTTTGGTCTATGCTTGTAAACAAGGTGTTGACAAGGTAAATGCATTGTTTCTTCTGATGAAATGTTCTGTTCGTCACAGAGATGCTGTATTTGTATGCTTTGATGATTACTGTATACATTGTTTCTGTTGTAGTTGCAATCCTGATAGTACTCGGTTACTTGCTCTAGCATCATGGGATTTCTAATTTATTTGCTAGGGTAATCTGTACTGTTATGGTCCTCTGGAAGGCTGCATGGACTGAATTTTCTGCAACTAGCTTGCTTGAGTTGCTGAATTTTCAATAATTATTGCATGCAGATTATAGATCTGGCAACGCTAACTGGTTTCTGCCGTGTTGCACTTGGCCCAAGCATTGCCGGTAATTCTAACTAAATGCTAACCCATCTTCACTCTTCTCTGCCAACTGCAATTTTTTACCCCTCCCAGTTATATTTAGTTCTTGCCCTGTTCTGGCATGTTCAAAGAAGCATCTCTACAGGGATTCTGACACCGAGTGATGAACTCCATGAGGAAGTGGCCGCTGCATCCGAGGTGTCGGGAGAGAAGTTCTGGAGGCTGCCACTAGAAGAAAGCTACTGGGAGACGATGAAGTCTGGTGTTGCTGATATGCTCAACACCGGCGCTATTCCACAGGGCGGCGTCATCACCGCTGCGCTATTCCTGAAGCAGGTGCGTACAGTATGATGTATTCTTGGGTTGCTGTTATGCTCAGCTCAGTTGCTTTCTTCTGGTTTGGTTCTTGGAAGAAACCTGAACGTTGTACTACAATATGTGTTTATATGAAACAATAAAAGTAATGCTCCTCGTGTTGCACTTTGTCGATGAGAAAGTTCAGTGGATGCACATGGACATTGCTGGGCCGGTGTGGAGCCACAAGAACCCGGTTCGGCGACGGGTTTG
Type
EST
SNP
PCR primers
BE443531A_F1 AGCTCATTTTTGTAAATACCG
BE443531_cpR1 TTCCTGAGAACCCATTCCAC
Linkage Group
1A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01