Query (optional)   in Class  

GrainGenes Probe Report: BE443531-1D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE443531-1D
Data at Wheat_SNP
BE443531-1D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;T>C;C>A;A>G;A>C;G>A;T>C;A>G;C>T at 3;4;5;9;10;79;130;460;915
SNP A>G;C>T at 108;159
Reference sequence GGAAACAACCCACTCTATACCTTGTTGTCCCCTTGTTTACAAGCATAGACCAAAGCATCAGCAAGTGGTGAGCCTCCCCTCTGCATCAGTGTTATCTACCTGAAAAGATATTTACAAAATAAGCGCAAATTGGACCATTCGAACGTAGTAACATCTAGCACCTGCTTAGACTACATCACCAAAACGCCACAATCATACTATCACAAGAAACATGCCTCGATCGTCTTGCCGTTAGAAGCAGTCACAATGTCGCCAGGCCTCATGCCTGTCCCACTAATCATGTTTTCACAGCCAGGCAAC
Reference sequence TTCTCACGAAAAGACGATCGAGGCATGTTTCTTGTGATAGTATGATTGTGGCGTTTTGGTGATGTAGTCTAAGCAGGTGCTAGATGTTACTACGTTCGAATGGTCCAATTTGCGCTTATTTTGTAAATATCTTTTCAGGTAGATAACACTGATGCAGAGGGGAGGCTCACACTTGCTGATGCTTTGGTCTATGCTTGTAAACAAGGTGTTGACAAGGTATATAGTGGGTTGTTTCCTCTGATGAAATGTTCTGTTCGTCACAGAGCTGCTGTATTTGTATGGTTTGATGATTGCTGTGTAAAACTATTGCAAGAATCTCTACTTCATATTTCTGCTGTAGTTGCAATCCTGATAGTACTCGGGTTACTTGCTCTAGCATCATGGGATTTCTAATTTATTTGCTAGGGTAATCTGTACTCTTATGGGCCTCTGGAGGGCTGCATGGACTGAATTTTCTGCAACTAGCTTGCTTGAGTTACTGAATTTTCAATAATTAATGCATGCAGATTATAGATCTGGCAACGCTAACTGGTTTCTGCCGTGTTGCACTTGGCCCAAGCATTGCCGGTAATTCTAACTAAATGCTAACCCATCTTCACTCTTCTCTGCCAACTGCAATTTTTTACTTCTCCCAGTTATATTTAGTTCTTGCCCTGTTCTTGCCCTTTTCTGGCATGTTCAAAGAAGCATCTCTACAGGGATTCTGACACCGAGCGATGAACTCCACGAGGAAGTGGCCGCTGCATCCGAGGTGTCCGGAGAGAAGTTCTGGAGGCTGCCACTAGAAGAAAGCTACTGGGAGACGATGAAGTCTGGTGTTGCTGATATGCTCAACACCGGCGCTATTCCACAGGGCGGCGTCATCACCGCTGCGCTATTCCTGAAGCAGGTGCGTATAGTATGATGTACAGTATCGGGTCGATGTTATGCTCAGTTCAGTTTCTTACTTCTGGTCTGATTCTTGGAAGAAACCTGAACATTGTGTTATACTGTATGCTTGGCCATATAGAAACAATATGTATTTATATGAAACAAAAAAAATAATGCTCCTCGTGTTGTAGTTTGTCGATGAGAAAGTTCAGTGGATGCACATCGACGT
Type
EST
SNP
PCR primers
BE443531_cpR1 TTCCTGAGAACCCATTCCAC
BE443531D_F2 ATCAGAGGAAACAACCCACTCTA
Sequence
NSFT03P2_Contig14190
Linkage Group
1D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01