Query (optional)   in Class  

GrainGenes Probe Report: BE443537-4A

Probe
BE443537-4A
Data at Wheat_SNP
BE443537-4A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL;DEL;DEL at 5;13;19
Reference sequence TGCTACAGCCTCCATGTCCATGTTCTGCCCTTCTTCAGGTTCTACCGGGGAGCCCAGGGCCGCCTCTGCAGCTTCAGCTGTACTAACGCAACCGTAAGATACTAATCTGGTCATGTGCCCTTTCATGCTCCTGTGAATTATAGACCGCGAGAGGAGTCAGAAACAAACAAACCATGTTTTAAGTTCCAAGAGATCCTCCCAAACTTACCTATCAAGGCTTTGAAAGCCTTCCATATAGCGTTACTTGGAGCTTACTGGTAGTGTAGGGATCGAAGGTCTTTCACTGAATTTGAAGGAACATATTATGGTCTCATCTTATTCTAGACGTGTAGTCAAGCGTATGATTTACCATTTGATGAGATGCTTACTATGGTGGCAATTGTCTTTTCAGATAAAGAAGTTCAGGGATGCGCTTGCCAAGCA
Reference sequence GTTCTACCGGGGAGCCCAGGGCCGCCTCTGCAGCTTCAGCTGTACTAACGCAACCGTAAGATACTAATCTGGTCATGTGCCCTTTCATGCTCCTGTGAATTATAGACCGCGAGAGGAGTCAGAAACAAACAAACCATGTTTTAAGTTCCAAGAGATCCTCCCAAACTTACCTATCAAGGCTTTGAAAGCCTTCCATATAGCGTTACTTGGAGCTTACTGGTAGTGTAGGGATCGAAGGTCTTTCACTGAATTTGAAGGAACATATTATGGTCTCATCTTATTCTAGACGTGTAGTCAAGCGTATGATTTACCATTTGATGAGATGCTTACTATGGTGGCAATTGTCTTTTCAGATAAAGAAGTTCAGGGATGCGCTTGCCAAGCAC
Type
EST
SNP
Sequence
NSFT03P2_Contig15391
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01