Query (optional)   in Class  

GrainGenes Probe Report: BE443596-7,4D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE443596-7,4D
Data at Wheat_SNP
BE443596-7,4D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>G;A>G;A>G;T>C at 79;118;335;418
Reference sequence CACTCCTGCTGCCCTCCCCATCTTGTTGACCCTGCAGATGAAATCATTTCAGTACATTGTTACTAAGAAGTATAGGTTTTTTCAGGCTCTCCTCTAACAAGATTAAGATGAGCTGCCACAAATTTATTAAAATAATCATCAATGCAGATAAGGTTTGTTAAGATCGTCTCCCGATCATGCAAGTGCACTAAACAATTGCGAGTACAAAAAGTAGATCATGTACTAGTACAATATTTCATTATCCATTAGAACCCACAGGATAACACACATGACTTCCTGTCTGTACGAGCTATGATTGGTACAATATCATACTCAGAATAGAAAATTATACTGCAAAATCCCGCATAATTTCACCAACAATCCACGCGCACAAGCAAGATATCTCCCCCAAAAGGCCAAATGGTTCTCTTCTCACCCTTCGTGGACCGATTCTCCCACCCAAATGAAACCAAGACCACAACTTTTTTTTCACCTGACAAAACATGGATATCGACCGTAGCAGCGAAGTCAACACTCAACACCCAGCGGCCAGGCACCACGAACAGGCCAAAATCCAGCGGATCTACTCTTATCTAGTCCACTAATAAGTGGTACAACGCCAAGCCATGTAATAATCAAACAAGCGAAGGAGGGGGGCCGATTCGTTTCACTCAATCAAGAAATAAACTGCCAAGGGTAGGAGGGGGTACTGACAGCAATCGAGATCTTTACCTGACTTCTGGGTTGCCG
Type
EST
SNP
Sequence
NSFT03P2_Contig14991
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01