Query (optional)   in Class  

GrainGenes Probe Report: BE443797-1D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE443797-1D
Data at Wheat_SNP
BE443797-1D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP INS at 415,1
SNP A>T;G>A;A>T;C>T;INS at 16;171;940;984;1014,2
Reference sequence ACGAAACATGAACCGAGCTGTCAACTTCATCGATGATTCCTTCTATGAGATGAACCTGCAATGGACAGGAAATATGTGAGTGTTTCAAATAGATATGCAATTCAGGGAACTCCACTGCTGCTTCAACTAGAGAGGAAGCACGATTTTGGCTCCCAAGAACATTCGGGGACGGCATTACTACTACTGGAACTGATGCACAAAATCTGGAAAGAAACTGAAACAGATCTTAAGTACTACCTCCGTCCGGGCTTATAAGTACCCTCTTTTGGGCTAAAGTTTGACCATAAATTTATAACTATAAAATGTAAACGACATGTCGTAAAAATTATATTATGGGAAATCTCTCTCAAATACAAATCCAACAATATATATTTTTTGTTTCATATAATTTATATTTTGTCAGGTTTACAGATGGCCAAAGTTTGACCCAAAATATGAGGGGGGCCCAATAAACCAGACAGAGGGAGTAGCACCCAGCATTCTGAAACAGATGGGAAGTAATGCCACGATGGACAGACAATACAAACAGTAGACGTAAAAAAAAAACAAGGTACGGGCATTTGTATATACCTCACACAACAACAGTTGGATTTGCAATCAAAACCCAACAGTTTTTAATAGCCCCTAAACAGTACGTCACAAGTGAACAGAAAGGAACTGAATATCAATACAGTAACACATCACGAATTATTAAAAATTGTTGTTCCATAACAACCCACTGTCTAAATATGTGTTGGGTTTTGATTCCCAAGCCATAACATAAAATACTGCAAGCATAAAACAAGAGGCATACAACAAAATACCATAGTTAAAAAAGGCGCGCCTAAGCGAGCGCTTAAGCGCGCCTACGCTCTAGGCGTTGGCAAAACGGATTGCGCATAACTATGCTTAATCTGTGCATAACTGCGCATAAGCATGCGCTTTGGTCAGTAAAGCGCAAGGCGGTGGCAAAACGCACAATTAACGCCTAAAGCTTTTTTGAACTATGCAAAATACACAAGCTTCTATGAACATAACGGAAATCTTATGGCGGAAGAATGTAGGAAATGGAGTTACCGAGAGGCTCTTCATAAGAAGACATTCCACTTTGCTGGTTGAAAGCTTAGTCTGCTTGGCAATAACACTTAATGGGATAGTTCTATCTTCTGATGGCCGGCTAAAGAATGCAACACAACAAAAAATATTAGGAAAAAACACGACAGGAAATGGAGGTGATATTGGAAAGTAATAGCCCAAAAATGGTACCTGAAGATTATCTCCATCAGACACAGAATATTGATCTTCTCAAGCAGTTTCTGTTCATTCTGCACCAATGCAGGCTGTGCACTAAGAGCAGCATTGTGAACCCCAC
Reference sequence TTTTGCCCCGCCTTGCGCTTTACTGACCAAAGCGCATGCTTATGCGCAGTTATGCACAGATTAAGCATAGTTATGCGCAATCCGTTTTGCCAACGCCTAGAGCGTAGGCGCGCTTAAGCGCTCGCTTAGGCGCGCCTTTTTTAACTATGGTATTTTGTTGTATGCCTCTTGTTTTATGCTTGCAGTATTTTATGTTATGGCTTGGGAATCAAAACCCAACACATATTTAGACAGTGGGTTGTTATGGAACAACAATTTTTAATAATTCGTGATGTGTTACTGTATTGATATTCAGTTCCTTTCTGTTCACTTGTGACGTACTGTTTAGGGGCTATTAAAAACTGTTGGGTTTTGATTGCAAATCCAACTGTTGTTGTGTGAGGTATATACAAATGCCCGTACCTTGTTTTTTTTTACGTCTACTGTTTGTATTGTCTGTCCATCGTGGCATTACTTCCCATCTGTTTCAGAATGCTGGGTGCTACTCCCTCTGTCTGGTTTATTGGGCCCCCCTCATATTTTGGGTCAAACTTTGGCCATCTGTAAACCTGACAAAATATAAATTATATGAAACAAAAAATATATATTGTTGGATTTGTATTTGAGAGAGATTTCCCATAATATAATTTTTACGACATGTCGTTTACATTTTATAGTTATAAATTTATGGTCAAACTTTAGCCCAAAAGAGGGTACTTATAAGCCCGGACGGAGGTAGTACTTAAGATCTGTTTCAGTTTCTTTCCAGATTTTGTGCATCAGTTCCAGTAGTAGTAATGCCGTCCCCGAATGTTCTTGGGAGCCAAAATCGTGCTTCCTCTCTAGTTGAAGCAGCAGTGGAGTTCCCTGAATTGCATATCTATTTGAAACACTCACATATTTCCTGTCCATTGCAGGTTCATCTCATAGAAGGAATCATCGATGAAGTTGACAGCACGGTTCATGTTTCGTGGGTCCAGCCTAGAGTACTTGGCATCCCACAGGTGAAGGCGTTGCGGAG
Type
EST
SNP
PCR primers
BE443797_cpR1 CCTCGATGGACAACAGTGTG
BE443797D_F2 ATAGAAGCTTGTGTATTTTGCAT
Sequence
NSFT03P2_Contig18059
Linkage Group
1D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01