Query (optional)   in Class  

GrainGenes Probe Report: BE443995-3B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE443995-3B
Data at Wheat_SNP
BE443995-3B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL;T>A;T>C;G>C at 38;122;199;469
SNP DEL;T>A at 38;122
SNP T>A at 122
Reference sequence GACCTTCAGCCTGTTCACTACTATAAGTTGTTCTAACTTTTTTTCTGATTCGGATGTAGACGCATTTTAGTGTGTTTGTTCACTCATTTCGGTCCATATGTACTCCATATTGAAATATCCATAACATCTTATATTTGTGAGCGGAGGGAGTACTAGTCAATTCTTACCATAACCATTCCATGTTTCATACCGCTCTTATGTTGTTACCGGAGAGGCAGTCTTGCTTTATTTATGCCCATAATTAACAGAAGTTCCCAACTTTGTGTAGCAAAACATGCTTGAATTTGATCATTTCGAGGATCAAGCTGCTGCGCAATAGGAGGGAGATGCAACTGATAAATATGCGCAAAGAGATGGTTCAATATCTTCAGACAGGCCAGGAGTCTATTGCGAGGATTCGGGTAACTTAGATTTACAGCTATATTTGTTTCCCAAGGTTCCGATCTTCTCCTTCATGCAGTTCTCTAAGATGCCATTATTAATAATAGGTGGAGCATATTATTCGGGAGCAAAATATATTGGCTGCCTATGAGATTGTTGAGCTTTTCTGTGAATTTGTTCTGGCACGAGTTCCCTATTAT
Type
EST
SNP
PCR primers
BE443995B_F5 CATCGACTTCAGCCTGTTCACTAC
BE443995_cpR2 aatagggactcgtgccagaac
Sequence
NSFT03P2_Contig13109
Linkage Group
3B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01