Query (optional)   in Class  

GrainGenes Probe Report: BE444256-6D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE444256-6D
Data at Wheat_SNP
BE444256-6D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G at 434
Reference sequence GGTCAAAATATTGTTGTGGTACTGGTTTTCATTTCTAATGTTTTAACTTTTAACTCATTGATCCCAACCTAAACAACATAGGAATGATATTTATTTTCATCCTTTCAGGTAGTAAAACGGCTTACTGATGGAGGGGCTGATTACTCTTTTGAATGTGTGGGTGATACTGGAGTAGTCTCGACTGCATTGCAATCATGTTCTGATGTAATTTTCTGTTCATCTTTTTCATTTCTAGTAATCGTGTGCCACAAAGTTTACTATTATGTTCAGATGCATTTTCTCCTCTCATGTTTGGTCTTGTCAGGGATGGGGACTGACTGTAACTCTTGGTGTACCAAAAGCAAAACCAGAAGTTTCTGCTCATTATGGATTGCTTCTCTCTGGAAGAACACTGAAGGGGTCTTTGTTTGGAGGATGGAGACCCAAATCTGACATACCTTTGTTAGTGGAGAAGTACGCAAACAAGGTAATTTGGAAAACTGTTGCAGAACCAAATGTTTTGTAATGCTTTTTCCAACTTTCAGTTAACAATGCTAAATTAAGCAACTGAACTTCATTATTCGTCTTGGTGTAATTAGTCTGTCCCTCTTTAGTGTGGCGTGAGATGGTTGAGGCAACTAGACATGATACTAGTATAATGGACGAGACATTGCAGAATCAACAGTTGCCACACAAAATAGATTCAATACATGTGGCATGTGTAATATAGTTTTCAACCGCGAGCAA
Type
EST
SNP
PCR primers
BE444256_cpR1 TCAAGCGCTTTGTTGATGTC
BE444256D_F3 GTGCTCACTCATAGACTGTG
Sequence
NSFT03P2_Contig17571
Linkage Group
6D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01