Query (optional)   in Class  

GrainGenes Probe Report: BE444562-5B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE444562-5B
Data at Wheat_SNP
BE444562-5B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP INS at 515,1
SNP A>G;DEL;T>G;G>A;T>G;A>C;A>T;T>C;A>G;C>T;DEL;C>G;G>C;A>C at 98;118;124;144;208;232;234;250;253;270;275-575;590;725;732
SNP A>G;DEL;T>G;G>A;T>G;A>C;A>T;T>C;A>G;C>T;DEL;C>G;G>C;A>C;G>A at 98;118;124;144;208;232;234;250;253;270;275-575;590;725;732;763
Reference sequence TAACTTATAAGCTTGCAAATCTGCAGAGGCGTTTCTGTTCAACTCTTGGGATGAACAATACTGCTGTTAAAGCAGCTCAGGAGGCAGTTCAGCGCTCAGAGGAGCTTGATATAAGGTTAGGCCTTTTTCCACCTTGTACACAGGAGATTGACTGGTCCTATGATCCTATCATGTTCCCACTTTGATTTAAATGAGACATGAAAGTTTTTCTAGTTAACCTCAACATTAGTCACAGGTCTACTTTTGACCTTGAAAGTCTCAATCACTGGCATCTATTCCTTATGCTCCTAAATATAAGTCTTTTTAGAGATTTCACTATAGACTACATTTGGATGTGTATAGATGCCTTTTAGAGTATAGGTTCACTCATTTTGCTCCTTATGTAGTCTATAGTGGAATCTCTTAAAAGACTTATACTCCCTCCGTTCTAAATATTTGTCCTTCTAGAGATTTCAAATGGACTACCACATACGGATGCATATAGACATAGTTTAGAGTATAGATTCACTCATTTTGCTCCTTATGTAGTCTATAGTGGAATCTCTTAAAAGACTTATACTAGGAACGGAGGGAGTAGCTTCATGCTTGACGTGGTTCCATGCAGGGTGACGTAAGGAGTCATAGACTATTAGAATAAAGAATATAACTAGTCTTAAGTTAATTACAAATGTGGCTAATGTGTACCCTTTGTAGCATGCTTTGGTAGATGCGATGTATGTAACTTGATATTAATAGTCATAGTATTTGACTCTTTAGACATGAGCCTGCTTTTACATGTCAATTTCCTAGTGCACACTTGTTGACCTAGAAAGATATGTTTACACTTCATTCCAATCTGCCGTGCAGGAGGAGTCCTATTTCA
Type
EST
SNP
PCR primers
BE444562_cpR1 TATAAATGACAGCAGCCGCA
BE444562X_F1 CTGGTTCGTTGCTACTTAGC
Sequence
NSFT03P2_Contig17509
Linkage Group
5B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01