Query (optional)   in Class  

GrainGenes Probe Report: BE444562-5D

Probe
BE444562-5D
Data at Wheat_SNP
BE444562-5D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>C;A>T at 366;592
SNP G>C;A>G;A>T at 366;507;592
Reference sequence TATGGAGATGGGAACCATCCATGCTGGAGATTTCCTGGTTTGTTGCTACTTATATTAGCATATATAAACTTGCAGTCGGAAGTTGATTACTTATAAGCTTGGAAATCTGCAGAGGCGTTTCTGTTCAACTCTTGGGATGAACAATACTGCTGTTAAAGCAGCTCAGGAGGCAGTTCAGCGCTCAGAGGAGCTTGATATAAGGTTAGGCCTTTTTCCACCTTGTACACAGGAGATTGACTGGTCCTATGATCCTATCATGTTCCCACTTTGATTTAAATGAGACATGAAAGTTTTTCTAGTTAACCACAATATTAGTCCCAGGTCTACTTTTGACCTTAGAAGTCTCAATCACTGGCATCTATTCCGTCTGTTCCTAAATACTCCCTCCGTCCGAGAATACTTGTCAAAGAAATGGATGTATCTAGACGTATTTTAGATCTAGATACATCCATTTTCATACATTTCTGTGACAAGTAATTCCGGACGGAGGGAGTATAAGTCTTTTTAGAGATTTCACTATAGACTACATTTGGATGTATATAGATGCCTTTTAGAGTATAGGTTCACTCATTTTGCTCCTTATGTAGTCTAAAGTGGACTTATATTTAGGAATGAAGGGA
Type
EST
SNP
PCR primers
BE444562_cpF1 GATGGGCCAATCTATGGAGA
BE444562D_R2 AAGCATGAAGCTACTCCCTTCA
Sequence
NSFT03P2_Contig17509
Linkage Group
5D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01