Query (optional)   in Class  

GrainGenes Probe Report: BE444599-2A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE444599-2A
Data at Wheat_SNP
BE444599-2A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T at 43
SNP C>T;C>T at 43;243
Reference sequence TGAAGCTTGAGAAGTAAGATTGCACAGATCAGCTTGTGCATGCCAATTACACTACATTTTTGCATGTCTTTCTACAAATCCATGGCATGCCATGTGTCATGCATGATTTTCTTGAATTCATTTACTCTTATGTTCTTTGCTGTTACTTTTGGAGCAAGCACATTTTAGGATAGAAAAGGAGTCTCGATCCCAAAACTTTGAGAGCAACACTAGGGGAGTAATACAATATCTACTTGAATAAGCACTCCCCAGTAAACACCGACAGAATTGGAGTAAGCTACACACACACCAAATGGTGGGCAATGATAGGTGGTATCTTTACCAATTTCGGTTCCTACAGTTGTTCTT
Type
EST
SNP
PCR primers
BE444599A_R1 CCCAAGTACCGGAAAGAACA
BE444599_cpF1 AAGGAGCAGATGGCTTTTGA
Sequence
NSFT03P2_Contig17602
Linkage Group
2A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01