Query (optional)   in Class  

GrainGenes Probe Report: BE444731-4A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE444731-4A
Data at Wheat_SNP
BE444731-4A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T at 352
SNP INS at 57,4
Reference sequence ATCATGAAGAAGGATTCCGCCAACCTCGGGCTCCGCTTCTTCCTCAAGTACGTACCCTGCCATTTCTTACATTACATGTAGAGGCACAATGAAGCCCCGATGCATCTCCTTGACATGCATGCTGCGTGCCGGTGCCTCCAGGATCTTTGAGATCGCGCCGTCGGCGAGGCAGATGTTCCCGTTCCTGCGCGACTCCGACGTGCCGCTGGAGACCAACCCCAAGCTCAAGACCCACGCCGTGTCCGTCTTCGTCATGGTAATACACCATGGATCTCCCAACGATCTACTCCTACTTACTATATTTACATATGCTTCCATGGCTGACCAATGTGTATGTGCATCCATGTGTTGCGATGAATCGCGCAGACGTGCGAGGCGGCTGCGCAGCTGCGGAAAGCCGGGAAGATCACCGTGAGGGAGAA
Reference sequence CTGCCATTTCTTACATTACATGTAGAGGCACAATGAAGCCCCGATGCATCTCCTTGACATGCTGCGTGCCGGTGCCTCCAGGATCTTTGAGATCGCGCCGTCGGCGAGGCAGATGTTCCCGTTCCTGCGCGACTCCGACGTGCCGCTGGAGACCAACCCCAAGCTCAAGACCCACGCCGTGTCCGTCTTCGTCATGGTAATACACCATGGATCTCCCAACGATCTACTCCTACTTACTATATTTACATATGCTTCCATGGCTGACCAATGTGTATGTGCATCCATGTGTTGCGATGAATCGCGCAGACGTGCGAGGCGGCTGCGCAGCTGCGGAAAGCCGGGAAGATCACCGTG
Type
EST
SNP
PCR primers
BE444731A_F1 TACGTACCCTGCCATTTCTTAC
BE444731_cpR1 TCTCCCTCACGGTGATCTTC
Sequence
NSFT03P2_Contig14673
Linkage Group
4A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01