Query (optional)   in Class  

GrainGenes Probe Report: BE445220-7D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE445220-7D
Data at Wheat_SNP
BE445220-7D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G at 344
SNP C>T;T>A;T>C at 104;116;160
SNP C>T;C>T;T>A;T>C at 62;201;213;257
Reference sequence GAGTTGCTTCAGAACCAGTTTTAAGGGATGTTACAAGATGTGGAATGCATATTGTAGCAGGCTCAGTGACTCTCAGACGAGGGAAATTGCTAAGTAAAGCATTGAGTGCTTTAAGATACTCCTCATTAGCACTCCCAGATGCCCATATATCCTTCTCAATTGAAGCTGCATACAAAGCACCATCATCAGGTAAATAAACTCTGGGTAGGAAATTAAAGCCACATTCCAGGGTGCCAGAAATAAATTGTTCTTCTTTTGGCTAGAAGATAAGAGTTAAAAACAATGCTATTTTGTGTAGAGAACCACTAAAATAGAATACTATCTTTTTTTCAAAGATGTTGCTTCGCTTTGCTATATATCATTTTGTTTGACTTGTTAATATTGAAGGCAGACTTTGACTTATATAGCATGAAAGGCACTGAAACACAACAAGTGATCCAACACAAACAAGAAAGGGGTATTGCTTTACCAGTTATAACTCTGACTGTTTCACTCGTGGCATACTCTTGGATAGTGTGGTTGTTGAATAGAAGTTTGACAAACATTGCTGCCTGAACAGAAGTATCAGGATTGCTTGAACTGATAAGGTCCAGCAAGACCTGGACGCCACCAGATTCTGCAACTGCTCTTTTATTTGCTCGGCTGTACATGACTAGATTCTGCAG
Reference sequence AGCATTGAGTGCTTTAAGATACTCCTCATTAGCACTCCCAGATGCCCATATATCCTTCTCAATTGAAGCTGCATACAAAGCACCATCATCAGGTAAATAAACTCTGGGTAGGAAATTAAAGCCACATTCCAGGGTGCCAGAAATAAATTGTTCTTCTTTTGGCTAGAAGATAAGAGTTAAAAACAATGCTATTTTGTGTAGAGAACCACTAAAATAGAATACTATCTTTTTTTCAAAGATGTTGCTTCGCTTTGCTATATATCATTTTGTTTGACTTGTTAATATTGAAGGCAGACTTTGACTTATATAGCATGAAAGGCACTGAAACACAACAAGTGATCCAACACAAACAAGAAAGGGGTATTGCTTTACCAGTTATAACTCTGACTGTTTCACTCGTGGCATACTCTTGGATAGTGTGGTTGTTGAATAGAAGTTTGACAAACATTGCTGCCTGAACAGAAGTATCAGGATTGCTTGAACTGATAAGGTCCAGCAAGACCTGGACGCCACCAGATTCTGCAACTGCTCTTTTATTTGCTCGGCTGTACATGACTAGATTCTGCAAGGCACA
Type
EST
SNP
PCR primers
BE445220_cpR1 GTGGTAGCCATTTGTGCCTT
BE445220D_F2 GGAAATTGCTAAGTAAAGCATTG
Sequence
NSFT03P2_Contig15393
Linkage Group
7D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01