Query (optional)   in Class  

GrainGenes Probe Report: BE445287-7B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE445287-7B
Data at Wheat_SNP
BE445287-7B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>A;C>G;T>G;G>T;C>A;G>T;C>T;A>T;A>T;C>T;G>A;C>A;A>T;C>A;T>C;A>T;C>A;G>A;C>A;T>C;A>T;G>T;T>C;G>T;C>A;A>T;A>G;T>C;T>A;T>A;G>A;C>A;T>C;T>C;C>A;G>C;T>C;G>T;C>A;T>A;C>A;T>C;G>T at 10;48;50;682;686;691;699;705;709;720;722;736;740;750;756;764;776;780;790;805;832;834;837;839;849;857;874;887;918;921;926;928;945;959;963;968;972;986;996;1006;1011;1043;1137
[ Show all 6 ]
Type
EST
SNP
PCR primers
BE445287B_F1 GGGCATGTGTCAAGGGC
BE445287_cpR1 TTCCCATGAAGAGGTGGTTC
Sequence
NSFT03P2_Contig6999
Linkage Group
7B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01