Query (optional)   in Class  

GrainGenes Probe Report: BE445287-7D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE445287-7D
Data at Wheat_SNP
BE445287-7D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>C;A>C;A>C;C>T;INS;T>G at 311;665;868;886;916,1;995
Reference sequence TTTGCCGGTTGGTTGGATATTTTCTGATTCTCAACTGTAACAGGGTGTTACTTAAATTCTATGGTGCTCTTTAGATAGACTAATATTGGTATTTGATTTATCTAATAAATGTTCATGTTAAGGGTAGCATAGTGGCAGTGGTTGTCATCTTAAATAAACTGACCTACCATGTAAACTTAAGTTACTCCTTATAATAGGATATATCAGTGTAAATTGCATTCTGTAAATATTAGACTTGCTGTGGAACTGACACCATGAATAGTGACTGGCTAGCCTGTATCTGACCTAACATGGTAACAAAAGCATTGCTACTTATGCTCCATGGTGTAACTCTGAGTTGTGACTGCGAGAGCGTATGCTATTCTAGGGCTTGTGTCAAGGGTCCGAGGTCTTATGAAATAAAATTCCTCCAGTTGTTCAAAAAGTCTTCATGATGTGAAAAGGGGCATATGTCCTTATTGTCAATTACCGTGTGTTTTTTCTTAAACCAGCCACTTCAGTTGCTTGGTCTTAAGGTTTCAGTACATGTACAATTTAAGTTAGCCCTAGTTAAGTACCACCGGTAGTTGCCTAGTTATGTATGTTTCTCTCCTGAAACCGGAGAAAGCAGGATGCCCAGAACATTGCTCGGGTAAATGCTGAAATATCATTGATTAATTATCAAAAAGTGCTAGTGTCCTATGAAACATTGTGTAGGCCGCAAATGTATCGTTAGTTTGTCAGTCCTGATAGTTGATTGGGACTCAGCCTATAAGCAGTCCTTGGCCATACATACTACTTAGACACTATTATTAGCTTGGTCCCAGTTTGGGAATCAACAAGTGCGATCTTGTCAAATGCAGTGGTGGTCCCAGTTTGAGGTAAACCACCCAAGTGTATTATGATCTATGTAAACTTATCATTACCAAAAAAAAAACAATCAAGAAATTGCCTCACACTGTACTTACTAATATTAGCTTTATGTAGCTCTGAACAAAGATCTCTTAAACTTCATTTGCGTTTTATACCAGATCTTTAACGAGTTC
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01