Query (optional)   in Class  

GrainGenes Probe Report: BE445431-2B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE445431-2B
Data at Wheat_SNP
BE445431-2B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G at 181
SNP G>A;T>C;C>T;G>A;T>C;C>T;A>G;T>A;T>C;G>T at 22;125;132;184;193;232;252;332;355;372
SNP T>C at 232
Reference sequence ATAAAGTAACAGAGAACGAGGGTCTTTCAAGACCTACCTCACTTTCATCATCAAGAACATGCTCCATCAGATAGACATCACAAATTTTTGCAATTTCTAGAAGAACCTCCAAGACAGAAGGTCTCACTGTGACATGATTCTGAAGAAAGACAATACATCCATGAATTCATTAGTTAGTCAATAAAAAATAGCAAAATTTGCTGAAGCATTTCTGCCCACCTGGAGCTCCTCTGGAGTTGTTTCCTCCAAAATCACACCAAGTAACCGGCAGGTAACCTGAAACAGTTCTTCCCACATTAGTGAAACACATGCCTTGGTCCAACAGGATGCTCGAAATTTTGTAACAACACTAAAAGCAGTGGTTTGCACAGTACCCTTCGCCCTTCGCTCAGTTTATGCCTGACAAGCTGCTCAAGAGTCAGCTGAAGAAGAAACAGGCAACTATCAACCTCAGGGTTATTTAAACATTAACATTATTTAGAAATAAACAAAGAAAGCACTACATTTACTGGTTGGAAAAGCTGATTGATCGCTTCATGTGCTCTTGAATCTACCGATGAGCAGGCATTCGTTCCGACCAAAGCACCTGGCTGTGATCTACTGCTTGTGTTGCTAGATGATGGAGCATCCCGTCTCCGTGGCCTCCGAGGTTGCTCTGGAGGAGCTCTCAACAGTTTC
Reference sequence CATCTAGCAACCAAGCAGTAGGTCACAGCCAGGTGCTTTGGTCGGAACGGATGCCTGCTCATCGGTAGATTCAAGAGCACATGAAGCGATCAATCAGCTTTTCCAACCAGTAAATGTAGTGCTTTCTTTGTCTATTTCTAAATAATGTTAATGTTTAAATAACCCTTAGGTTGATAGTTGCCTGTTTCTTCTTCAGCTGACTCTTGAGCAGCTTGTCAGGCATAAACTGAGCGAAGGGCGAAGGGTACTGCACAAACCACTGCTTTTAGTGTTGTTACAAAATTTCATGCGTCCTGTTGGACCAATGCATGTGTTTAACTAATGTGGGAAGTACTGTTTCAGGTTACCTGCCGGTTACTTGGTGTGATTTTGGAGGAAACAACTCCAGAGGAGCTCCCGGTGGGCAGAAATGCTTCAGCAAATTTTGCAATTTTTTATTGACTAACTAATGAATTCATGGATGT
Type
EST
SNP
PCR primers
BE445431B_R2 CATGCATATGATGATGGTGCACAC
BE445431_cpF1 GCCTGGAAACTGTTGAGAGC
Sequence
NSFT03P2_Contig16701
Linkage Group
2B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01