Query (optional)   in Class  

GrainGenes Probe Report: BE445508-3A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE445508-3A
Data at Wheat_SNP
BE445508-3A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>G;INS;INS at 35;531,1;559,1
Reference sequence GCAGTATGCGATGCTGAAGAAGGTGATATAGCAACAGAGACAAAGACAAATTCCGATGGGTCATTCTTTGCAGGGCCCTTGTATGAGGATATAGGATATGAAATCGAAGCCTCAAAGGTCTATACTTTTTTCTGCACACACATTATGTGTAATCGCTAGGGTGTTGACCTCCGGTGTTGACTTCATGGTCATATGCTGCAACTGTGTACCGTACTACAGTGTATTAGTATGATTTCTCAGTTTTCATATTTTGTTTTTGCTGGTGATACAAACTGTTTTCCAGTCACTCTTTTTTTCAAATAGGAAAGACGTGGTAAGTGATGTTTGCATGGAGCACCACTTTATTTTATTTACCTTTGCACTAGACTAGTCAATGTGATTTCTTGTAAACTGCTTAGTCAGAAGTGGTTCCAGTCTTGTTCATTCAAGCTTAAACAGTGCACTGTTCAATATAGTATGCCCTAGTTACATTTAACCACAACTGGGAAGGGAACTTTTAGAATCAGCAACCAAAAACGTGTGTTTTCTTTATATCCTATATCTGATATCATTCCTTCCTCAGGCTGGCTA
Reference sequence CCAGTCACCTCTTTTTTCAAACAGGAAAGACGTGGTAAGTGATGTTTGCATGGAGCACCACTTTATTTTATTTACCTTTGCACTAGACTAGTCAATGTGATTTCTTGTAAACTGCTTAGTCAGAAGTGGTTCCAGTCTTGTTCATTCAAGCTTAAACAGTGCACTGTTCAATATAGTATGCCCTAGTTACATTTAACCACAACTGGGAAGGGAACTTTTAGAATCAGCAACCAAAAACATGTGTTTTCTTTAATATCCTATATCTGATATCATTCCTTCCTTCAGGCTGGCTACAATCCTCAAGCA
Type
EST
SNP
Sequence
WHE1135_C02_F03ZS
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01