Query (optional)   in Class  

GrainGenes Probe Report: BE445508-3D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE445508-3D
Data at Wheat_SNP
BE445508-3D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>G;G>C;A>T at 149;230;266
[ Show all 7 ]
Type
EST
SNP
PCR primers
BE445508_cpR1 GCTTGAGATGATAGCCAGCC
BE445508D_F1 TGCACACACATTATGTGTAATGGT
Sequence
NSFT03P2_Contig2928
WHE1135_C02_F03ZS
Linkage Group
3D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01