Query (optional)   in Class  

GrainGenes Probe Report: BE445628-2B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE445628-2B
Data at Wheat_SNP
BE445628-2B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A at 109
SNP T>C;G>A at 72;109
Reference sequence GTCCAAGTCATCTCCCACAGTAAGACAATGATTGATGTACTCCCTTTGTCCCAAAATAAGTGTCGCTGCTTTAGTACAAATTTAGTACAAAGTTGTACTAAATCAACGGCACCCAAACTGTTAGTATATCAAATTAGAAGTGGATGTATCAGGTCCAACCCAAGCTGTTATGGTTAATTGTGCAATGTGGCTTTTGTCAGGCCAGGGCATCAAACAAACATGACAAATTCAAAAAGTAAACAAATGTTGGTGTATTCTGGAGCGGGGGTTACACATTTTAGAATTTGAACTAGTGTATTAGAAGGGTGAAAAGATAGTTTTAAGTTTTAACTATTAACGTGTGCCAGTTTTTTTTTCTATTGTCCTTTTTAATTTTACTCTTAACACAAAACGAGTTTGAATTTGAAATTTATACATAGGTAATGTAAACTGAGAGTACATGGTTTTTTATTTGGGTATTTTCATATTGATTTGGGCCCTCAACAGATCAGGTACTCTTTGAACCCACCC
Type
EST
SNP
PCR primers
BE445628B_R2 ATTCATGGGTGGGTTCATAG
BE445628_cpF1 cgttatcagcatcgtccaagtcatc
Linkage Group
2B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01