Query (optional)   in Class  

GrainGenes Probe Report: BE445628-2D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE445628-2D
Data at Wheat_SNP
BE445628-2D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G;A>T at 177;355
Reference sequence TAATCGTGCAATACCCCCAAGCTGTTAGTATATCAAATTAGAAGTGAATGTATCAGGTCCAACCCAAGCTGTTAGGGTGTAATTGTGCAATGTGGCTTCTGTCAGGCCAGGGCATCAAACAAACATGAAAAATTCAAAAAGTAAACAAATGTTGGTGTAATCTAGAGCGGGGTTACACATTTTAGAATTTGAACTCGTGTATTAGAAGGGTGAAACGATAGTTGTAACTATAAATGTGCCAGTTTTTTTCTTCTATTTTCCTTTTTATTTCTACTCTTAACGCAAAACGAGTTTGAATTTGAAACTTATACATAGGTAATGTAAACTGAGAAGTACATGGTTTTTTATTTGGGTATTTTCATATTTGATTTGGGCCCTCAACTGATCAGGTACTATTTGAACCCACCCATGAAAGGTCTGTCTCAAACTTAGATGTGCAAGCATGAGATTCCCTACTTCCGGATATAGCGGGTTACACTTGCACCTGATATGTTGCCATTAAGCTAATATGTACAATTACTTTTAAATATCAACATATAGGCGGTATACTAAATGTCCACCAAGTTTTATGCTTAGTATTTTAGTAACAAAAGCATGACGTTTATGTAGTAAGGCATCGTATCAGCTTAAAACATATGGTCTGTAAGTTGAATGTGTTCCGTTCTTGAATTATTCTTTCAGATTGTAATATATTAACAATTGCAAATATTTTATTGCCACCAGGAGCTTGT
Type
EST
SNP
Sequence
BE445628
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01