Query (optional)   in Class  

GrainGenes Probe Report: BE446058-5A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE446058-5A
Data at Wheat_SNP
BE446058-5A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;G>C;INS at 445;541;574,1
Reference sequence GAATACAGATCATATTATACTTTTTTAGTCCATTTTCTTTATTCATTTGCTAGTTGCTAACATCTGTTAAACTCATCTTTTGAAAATGAAACAGTTCAAACTTGATAATGTCTTGAAACTGTAACCATGCTGAACGCTTGTTCTGAATGGAATCATTCAAGTGAAAGTTAAGTAGTTAACTATCTGTGTCTTTCATATATTTAATGCAGGCACTCATAGCTGATTTTGAATTATCTGAGGGAATCTATTCGCGTGCTAAAATCGAGGACTCTGACTCAGTGTGCCTATGGTTGGGTGCAAATGTGATGCTGGAATACTCCTGTGACGAGGTATAGTTTTAAGCATTGTCATATTGCTGTCCTTCGATTTTTAGTTTCCCCCTTCATCTCTGGGAGTTTTGCAGGCCAATGAGCTCTTGAAAAGTAACTTGGAAAATGCGAGGGCCAGTTTAGAAGTCCTTGTTGGCGATCTTCATTTCTTACGGGACCAGCAAACGATAACTCAGGTAAAATGGCCATGATTAGTTTGACTACTCACCATGATCTCACGCTCAGTATTGCTAAACTCAATTATTGTCAGG
Type
EST
SNP
Sequence
NSFT03P2_Contig9978
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01