Query (optional)   in Class  

GrainGenes Probe Report: BE446161-4B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE446161-4B
Data at Wheat_SNP
BE446161-4B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G;T>C at 162;478
[ Show all 6 ]
Type
EST
SNP
PCR primers
BE446161B_R1 CGTGTTTCCAGGCTCCAGT
BE446161_cpF1 GTAGCAGGCAGGTTGGAGAG
Sequence
NSFT03P2_Contig17161
Linkage Group
4B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01