Query (optional)   in Class  

GrainGenes Probe Report: BE446240-1B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE446240-1B
Data at Wheat_SNP
BE446240-1B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G;A>G;C>T at 135;199;233
[ Show all 8 ]
Type
EST
SNP
PCR primers
BE446240B_F3 GTCTAACTTTGGCCTTTTATCTTA
BE446240_cpR1 ACATCAGAAGGTGAAACCGC
BE446240_cpR1 CGACGTTGTGGGTGTATGAGBE445113-1A
PCR_primers
Linkage Group
1B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01