Query (optional)   in Class  

GrainGenes Probe Report: BE446480-2B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE446480-2B
Data at Wheat_SNP
BE446480-2B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>A;DEL;C>T;G>T;T>A at 109;331-335;346;393;413
Reference sequence CTGTGAGAATGCAGGCCAAGTTGTAAGCTTCCTCAGAGTGCTTCTCCTGCAGAGATAAAACCCAATTTAACAAACATTACCATTTGCTCTGTAGCATAAAACGATTCATTGCTACTAATATGAATCCCATTTTGTACACAAATTATGGAAGCAGCTTCACACAATATAATTCACATTCAATCGAACTAGGAAATAAAAACAATACTGGTTTAAGAATCGCCACAAACTTTACCTTGGAGAAATATCCCACCATATGGCATCCCCGATCATCACATTCACACAGGATATAGAACAAGAACAAATCCACATCATAGTAGAGTGTTTTGTGATCAAGGAATAGCTTGGCCAGGTAGCAAAGGTTC
Reference sequence CTCCGGTGTTCCCACTTTACCTTCCTTTTTAGAAAGCTCATAAGCTGTCATAATAAAGAAAATTCAACTATGAACAAAATGCTAGAGTGGAGAAACAGTTTAGTCCATCAGAAAATCAAAAGCTAACAATGAGATGAGAAATATAGCATAAGTTCAGACTTACAGAAAGCAATCAGGAACTTTCCGTAACCCTTTCTTTGGTATGGAGGGAGAGTGAGAATGCAGGCCAAGTTGTAAGCTTCCTCGGAGTGCTTCTCCTGCAGAGATAAAACCCAATTTAACAAACATGACCATTTGCTCTGTAGCATAAAACGATTCATTGCTACTAATATGATATGAATCCCACTTTGTACACAAATTATGGAAGCAGCTTCACACAATATAATTCACATGCAATCGAACTAGGAAATAATAACAATACTGGTTTAAGAATCGCCACAAACTTTACCTTGGAGAAATATCCCACCATATGGCATCCCCGATCATCACATTCACACAGGATATAGAACAAGAACAAATCCACATCATAGTAGAGTGTTTTGTGATCAAGGAATAGCTTGGCCAGGTAGCAAAGGTTCTG
Type
EST
SNP
Sequence
NSFT03P2_Contig13772
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01