Query (optional)   in Class  

GrainGenes Probe Report: BE446672-1B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE446672-1B
Data at Wheat_SNP
BE446672-1B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;T>C at 213;364
SNP C>T at 213
Reference sequence TTTCGTTTCACAGAAGAAAACTGGCATGCAAACCCACGTATAAAAAGCAGTGGACTTCTGAAAGACGTCTGCTTACCAGGAGGAACATTTTCTGGCGAGTTTGTCTGGAAAAACCTGGTATGATGGTTTTTCTGAGCAACAATGACCGTGAACTTGGGCTCCCACTTGTCGTCAAGGCACTTGCATGCCTGCATTGGTTGGTTAAAAGTAGACCAAATGAGTGACGCTGTCCAGCTCCAGCACGGGATAATTACTGTAAGAAGCACAAGTTGGGATCGAATAAATACACTACCTCAATGATCTGCTCAAGCTCAATGTTTATCACCTGAGTAAACTGGCTTTCGCTAACTCCATCCCTGAAAGTAGCATGAGTTATATCCATTTTCAGCAGAGCAACATTTGAGGAACTACAAAAAATTACTGCTATATATTAGCAAATACTCCTAGTAGTTTCACAACTTGGTACCTGAAAATAATAACTTGGTCTGGCTTTCGCTTCCCAGAGCTAGTGTAGAAGTCAATAAGAGATTCCCTGGAAATCCATTCCATTCCATTAGGGGAGGCGTCCAACAAAGCACAACATACATACTACAAACACCCACACCACAGTTTGGACAATGAACTGGACTCGAGATTGACACGTACCGAANGAGGCCATCATCT
Type
EST
SNP
PCR primers
BE446672B_R2 CTGTTACAATCTATCGTTTCGTTT
BE446672_cpF1 ACGGGGAACTGAAGATGATG
Sequence
NSFT03P2_Contig14968
Linkage Group
1B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01