Query (optional)   in Class  

GrainGenes Probe Report: BE446672-1D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE446672-1D
Data at Wheat_SNP
BE446672-1D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>A;A>T;G>T;G>A;C>A;T>C at 108;410;479;510;588;623
[ Show all 7 ]
Type
EST
SNP
PCR primers
BE446672A_F1 CCCCTAATGGAATGGAATGCAC
BE446672_cpR1 GTTCTTGGGATGGCACACTT
Sequence
NSFT03P2_Contig14968
Linkage Group
1D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01