Query (optional)   in Class  

GrainGenes Probe Report: BE446786-2A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE446786-2A
Data at Wheat_SNP
BE446786-2A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G;A>G at 253;291
Reference sequence GTCTTCTTTGCCCTTAGGCTCAACTTGGATGGTCTACTCTTTCCCACGTCGAGGCACATTTCTTATGACAATAAGAGATTTACAATCATAACCATCTCACTCCTCGTGGTTATTTATACTGCTGCCATCTTCATACCAAGCATTTGGGATGCATTCCAGTTTACTGGCGCCACAGCTGCCGTTTTGATTGGTTTTATCTTTCCTGCCATGGTCATATTAAGGTACCTAAATAATGCTTCTGATTGGCTATATATTCCCTATTTGCTAAGCACTCCCGTATTAACACATAAACTCGTTCTTTTTTTCCAAGGGATCCTTATGGAATCGCAACCAAGCGTGACAAGATATTGGCTGTAACCATGATCGTGCTTGCTGTTGTCTCAAACTCTGTTGCCCTATACAGTGATGCG
Type
EST
SNP
Sequence
NSFT03P2_Contig14249
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01