Query (optional)   in Class  

GrainGenes Probe Report: BE471213-6B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE471213-6B
Data at Wheat_SNP
BE471213-6B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>C at 433
[ Show all 6 ]
Type
EST
SNP
PCR primers
BE471213B_R1_UCD CCTCTGCTTTCCTGTACACTAAGAA
BE471213_cpF1_UCD GTCTTTCTCCTTGGCTGTCG
Linkage Group
6B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01